View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11168_low_52 (Length: 257)

Name: NF11168_low_52
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11168_low_52
NF11168_low_52
[»] chr4 (1 HSPs)
chr4 (14-93)||(54912740-54912819)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 93
Target Start/End: Original strand, 54912740 - 54912819
Alignment:
14 agatccaagaaatacttagaaagatcttttgtttatacttcaaaatgaattcaaaacaacaccataaagctaccaagtct 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54912740 agatccaagaaatacttagaaagatcttttgtttatacttcaaaatgaattcaaaacaacaccataaagctaccaagtct 54912819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University