View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_low_57 (Length: 252)
Name: NF11168_low_57
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_low_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 71 - 236
Target Start/End: Complemental strand, 43096382 - 43096217
Alignment:
| Q |
71 |
tttagacttaagcactgggctaatttttgatgaacttagtaagacaatgttgatttggcaaagagagacctcaaacttgtatgagaacagattaagcaaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43096382 |
tttagacttaagcactgggctaatttttgatgaacttagtaagacagtgttgatttggcaaagagagacctcaaacttgtatgagaacagattaagcaaa |
43096283 |
T |
|
| Q |
171 |
agtaagaaaacaacctaaaaaattgagttcagtaccaataaatcatgaaattattgaagaagtcaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43096282 |
agtaagaaaacaacctaaaaaattgagttcagtaccaataaatcatgaaattattgaagaagtcaa |
43096217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University