View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_low_64 (Length: 245)
Name: NF11168_low_64
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_low_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 19140310 - 19140094
Alignment:
| Q |
14 |
gaacccttctctttcttatgcttttcaatttctttcatgcttatggaaataaagcttcacacttgacgtattttctctacctactatcaataatgtattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19140310 |
gaacccttctctttcttatgcttttcaatttctttcatgcttatggaaataaagcttcacacttgacgtattttctctacctactatcaataatgtattt |
19140211 |
T |
 |
| Q |
114 |
tggaaatttcattagaaaagaaactttacatttacattacactctttcttatatgaataatttaattatataagacactttgcaaaaggttttactagag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19140210 |
tggaaatttcattagaaaagaaactttacatttacattacactctttcttatatgaataatttaattatataagacactttgcaaaaggttttactagag |
19140111 |
T |
 |
| Q |
214 |
ttgaaaagaatgaaact |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19140110 |
ttgaaaagaatgaaact |
19140094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 35 - 155
Target Start/End: Original strand, 40907998 - 40908119
Alignment:
| Q |
35 |
ttttcaatttctttcatgcttatggaaataaagcttc-acacttgacgtattttctctacctactatcaataatgtattttggaaatttcattagaaaag |
133 |
Q |
| |
|
|||| ||| ||||||||| |||| ||||||||||||| |||||||| || ||||||| ||||| ||||| |||||||||| ||||||| ||||| ||| |
|
|
| T |
40907998 |
tttttaatgtctttcatgtttatagaaataaagcttctacacttgatgtgaattctctatctactctcaattatgtattttgaaaatttctttagataag |
40908097 |
T |
 |
| Q |
134 |
aaactttacatttacattacac |
155 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
40908098 |
aatgtttacatttacattacac |
40908119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University