View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11168_low_71 (Length: 240)

Name: NF11168_low_71
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11168_low_71
NF11168_low_71
[»] chr8 (2 HSPs)
chr8 (18-137)||(43453405-43453524)
chr8 (201-240)||(43453588-43453627)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 43453405 - 43453524
Alignment:
18 cttcttaaacgggccggtattgacaaaggtcccagaagtgatgtgcaggtggatcatatgagcaacttcttctcagaaatcgaaataactgcagtaatgt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43453405 cttcttaaacgggccggtattgacaaaggtcccagaagtgatgtgcaggtggatcatatgagcaacttcttctcagaaatcgaaataactgcagtaatgt 43453504  T
118 tctttgaaacttttaaagta 137  Q
    ||||||||||||||||||||    
43453505 tctttgaaacttttaaagta 43453524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 240
Target Start/End: Original strand, 43453588 - 43453627
Alignment:
201 gtgttctattattttaaaaatattgttatatactcggaat 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
43453588 gtgttctattattttaaaaatattgttatatactcggaat 43453627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University