View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_low_71 (Length: 240)
Name: NF11168_low_71
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_low_71 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 43453405 - 43453524
Alignment:
| Q |
18 |
cttcttaaacgggccggtattgacaaaggtcccagaagtgatgtgcaggtggatcatatgagcaacttcttctcagaaatcgaaataactgcagtaatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453405 |
cttcttaaacgggccggtattgacaaaggtcccagaagtgatgtgcaggtggatcatatgagcaacttcttctcagaaatcgaaataactgcagtaatgt |
43453504 |
T |
|
| Q |
118 |
tctttgaaacttttaaagta |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43453505 |
tctttgaaacttttaaagta |
43453524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 201 - 240
Target Start/End: Original strand, 43453588 - 43453627
Alignment:
| Q |
201 |
gtgttctattattttaaaaatattgttatatactcggaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43453588 |
gtgttctattattttaaaaatattgttatatactcggaat |
43453627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University