View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11168_low_78 (Length: 230)
Name: NF11168_low_78
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11168_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 2013623 - 2013816
Alignment:
| Q |
18 |
ggggtaaagacgttttggctgtgagatgaaatccagagttgtttgcatctcgtttccttcccgcgcttcccattatcatttctgttgaacgcaacgcaag |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
2013623 |
ggggtaaagacgttttagctgtgagatgaaatccagagttgtttgcatctcgtttccttcccgcgcttcccactatcatttctgttgaacgcaacgcagg |
2013722 |
T |
|
| Q |
118 |
ttggtgttcttgttgtttctgatgattcattttttactctgttcttctaattttcatttccatgtctaattcctccaaacatacacctatgaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2013723 |
ttggtgttcttgttgtttctgatgattcattttttactttgttcttctaattttcatttccatgtctaattcctccaaacatacacctatgaaa |
2013816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University