View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11168_low_79 (Length: 230)

Name: NF11168_low_79
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11168_low_79
NF11168_low_79
[»] chr2 (2 HSPs)
chr2 (16-214)||(41037167-41037367)
chr2 (101-184)||(41031689-41031772)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 41037367 - 41037167
Alignment:
16 agagtacaagtttgcgaataagttttcattcaagttaatcaaacaaacatgatggaagagtgctaactatatcagctgctgcaaaagtaacaaaaaatga 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
41037367 agagtacaagtttgcgaataagttttcattcaagttaatcaaacaaacatgatggaagagtgctaactatatcagctgctgcaaaagtaacaaaaagtga 41037268  T
116 caa--actgtaactaacaatatattaaactactttaactaacaactgtttttcctggaatgggatcatgattcatcaataagtctggtggtaaattcatt 213  Q
    |||  ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
41037267 caaacactgtaactaacagtatattaaactactttaactaacaactgtttttcctggaatgggatcatgattcatcaataagtccggtggtaaattcatt 41037168  T
214 c 214  Q
    |    
41037167 c 41037167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 101 - 184
Target Start/End: Complemental strand, 41031772 - 41031689
Alignment:
101 agtaacaaaaaatgacaaactgtaactaacaatatattaaactactttaactaacaactgtttttcctggaatgggatcatgat 184  Q
    ||||||||||| | | ||||  |||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||    
41031772 agtaacaaaaagtaagaaacactaactaacaatagatgaaactactttaactaacaactgtttttcctggaatgcgatcatgat 41031689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University