View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1116_low_11 (Length: 318)
Name: NF1116_low_11
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1116_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 40 - 224
Target Start/End: Complemental strand, 35364805 - 35364621
Alignment:
| Q |
40 |
tagtcatttaaggttttctctactttggattgaaatatcattctcttactctaaatttttctttttcaaaaatttaaatcaatggaatttttgtgtcgaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
35364805 |
tagtcatttaaggttttctctactttggattgaaatatcattctattactctaaatttttctttttcaaaaatttaaatcaacggaatttttgtgtggaa |
35364706 |
T |
 |
| Q |
140 |
ttaaagggtttcgtaattattttctaacttacaacgaattattggtgaacaggatttgttacatcaaagaaagcttgttgtgagt |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364705 |
ttaaagggtttcataattattttctaacttacaacgaattattggtgaacaggatttgttacatcaaagaaagcttgttgtgagt |
35364621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 221
Target Start/End: Complemental strand, 35376422 - 35376388
Alignment:
| Q |
187 |
aacaggatttgttacatcaaagaaagcttgttgtg |
221 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35376422 |
aacaggatttgttacatcaaagatagcttgttgtg |
35376388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University