View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1116_low_14 (Length: 302)
Name: NF1116_low_14
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1116_low_14 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 26 - 189
Target Start/End: Complemental strand, 47289338 - 47289175
Alignment:
| Q |
26 |
atcaccttcaacccatgatgaagagagtgaatcaattgtgattgggaggaggccaagagattgagttgtcgacgcaagtgagggaatacggcgacgaatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
47289338 |
atcaccttcaacccatgatgaagagagtgaatcaattgtgattgggaggaggccaagagattgagttgtcgacgcaagtgagggaacacggcggtgaatg |
47289239 |
T |
|
| Q |
126 |
agaccaatgtccatgaggaaacgaagagagtgagaggagatcgagcggttgggaggagacaaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47289238 |
agaccaatgtccatgaggaaacgaagagagtgggaggagatcgagcggttgggaggagacaaag |
47289175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 47289170 - 47289106
Alignment:
| Q |
212 |
tgggcttcatcccgga-cttagggaaagagggatggaagtgagagcaagggcccaaagtttcaga |
275 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
47289170 |
tgggcttcatccccgaacttagggaaagagggatcgaactgagagcaagggcacaaagtttcaga |
47289106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 192 - 261
Target Start/End: Complemental strand, 33283 - 33213
Alignment:
| Q |
192 |
agttggagagacaacgacggtgggcttcat-cccggacttagggaaagagggatggaagtgagagcaaggg |
261 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| | |||||||||||||||||||| |||| |||||| |
|
|
| T |
33283 |
agttggagagacaatgacggtgggcttcatccccgaatttagggaaagagggatggaaccgagaacaaggg |
33213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University