View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1116_low_15 (Length: 287)
Name: NF1116_low_15
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1116_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 51845071 - 51845356
Alignment:
| Q |
1 |
acatctcgataacaatgagttctctggtcctattccagaattcaaacaagatattaaatctttagacgtgtctaacaacaagttacaaggtgcaatacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51845071 |
acatctcgataacaatgagttctctggtcctattccagaattcaaacaagatattaaatctttagacatgtctaacaacaagttacaaggtgcaatacct |
51845170 |
T |
 |
| Q |
101 |
ggtcccttgtccaagtatgaggcaaaatcttttgcaggaaatgaagagctttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845171 |
ggtcccttgtccaagtatgaggcaaaatcttttgcaggaaatgaagagctttgtgggaagccacttgacaaagcatgcgatccttcttcggatttaacgt |
51845270 |
T |
 |
| Q |
201 |
caccacctagcgatggatccggacaagatagtggtggtggtggtagtggtactggttgggctttaaagtttattggaattcctttg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51845271 |
caccacctagcgatggatccggacaagatagtggtggtggtggtggtggtactggttgggctttaaagtttattggaattcttttg |
51845356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University