View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1116_low_19 (Length: 251)
Name: NF1116_low_19
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1116_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 7634993 - 7634771
Alignment:
| Q |
1 |
ttgtagagaactttttgatctaatcagttctaaaaatctgaattgacatttatcaaaaagaaaaagaacatttgatatgaaannnnnnnnnnnnnnacaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7634993 |
ttgtagataactttttgatctaatcagttctaaaaatctgaattgacatttatcaaaaagaaaaagaacatttgatatgaatattttttggttttcacaa |
7634894 |
T |
|
| Q |
101 |
taatttgatatgaatataatttagaatgtcggtatgtacactatttgtttgttacaatttcatggcaggtgcatccatcagaaacataacatgtgaaaat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7634893 |
taatttgatatgaatctaatttagaatgtcggtatgtacactatttgtttgttacaatttcatggcaggtgcatccatgaggaacataacatgtgaaaat |
7634794 |
T |
|
| Q |
201 |
ctggtatgatataacatggattt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7634793 |
ctggtatgatataacatggattt |
7634771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 194
Target Start/End: Original strand, 7804986 - 7805055
Alignment:
| Q |
120 |
tttagaatgtcggtatgtacactatttgtttgttacaatttcatggcaggtgcatccatcagaaacataacatgt |
194 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7804986 |
tttaaaatgtcggtatgtacacta----cttgttacaatttcatggcaggtgcatccatgag-aacataacatgt |
7805055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University