View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1116_low_9 (Length: 339)
Name: NF1116_low_9
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1116_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 52483145 - 52483052
Alignment:
| Q |
119 |
cgcctctaaatccaacgatctcatctccctcgctcgccactatggaaactgctattcccaactctccaaagctcgtctcaggtgaacctttcac |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52483145 |
cgcctctaaatccaacgatctcatctctctcgctcgccactatggaaactgctattcccaactctccaaagctcgtctcaggtgaacctttcac |
52483052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 325
Target Start/End: Complemental strand, 52482949 - 52482916
Alignment:
| Q |
292 |
gaaactaaattttagtttgctcgtggttgcaaca |
325 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
52482949 |
gaaactaaattgtagtttgctcgtggttgcaaca |
52482916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University