View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11170_low_10 (Length: 351)
Name: NF11170_low_10
Description: NF11170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11170_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 119 - 338
Target Start/End: Original strand, 40633456 - 40633676
Alignment:
| Q |
119 |
tacctcttctcccacgttcatacatctccactttattcaacaggggtcctcctacctttcttttgtaaggctaatcaaacaacaattcacgtagacgtct |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40633456 |
tacctcttctcccacattcatacatctccactttattcaacaggggtcctcctacctttcttttgtaaggctaatcaaacaacaattcacgtagacgtct |
40633555 |
T |
 |
| Q |
219 |
aatatgtgttgttactgactgcacatagtttggttttgcgtaacacggggcag-acttgggtgacatagcaattagtaacattgatcaaccacaaagtta |
317 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||||||| |||| || ||||||||||||||| | ||||| ||||| ||||||||||||||| |
|
|
| T |
40633556 |
aatatgtattgttactaactgcacatagtttggtttcgcgtaacatggggtagtacttgggtgacatagtatttagtgacattagtcaaccacaaagtta |
40633655 |
T |
 |
| Q |
318 |
taaatgttaaatgaaaaaact |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40633656 |
taaatgttaaatgaaaaaact |
40633676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 86 - 124
Target Start/End: Complemental strand, 40633947 - 40633909
Alignment:
| Q |
86 |
cacgctcttgtttacattaaatgggtcccatattacctc |
124 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40633947 |
cacgctcttatttacattaaatgggtcccatattacctc |
40633909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University