View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11170_low_17 (Length: 203)
Name: NF11170_low_17
Description: NF11170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11170_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 6351223 - 6351394
Alignment:
| Q |
18 |
ataagtgttggtatttagtctctctctgtaactatatttttgttatgttttttcagagctgaatgtgatctaaatttttaattcttctcaaatgataata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6351223 |
ataagtgttggtatttagtctctctctgtaactatatttttgttatgttttttcagagctgaatgtgatctaaatttttaattcttctcaaatgataata |
6351322 |
T |
|
| Q |
118 |
tttttaaattgtatattcaaagagcaggtaatgttcgaccagtctcaactctcaactatctgcatttgtttc |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6351323 |
tttttaaattgtatattcaaagagcaagtaatgttcgaccagtctcaactctcaactatctgcctttgtttc |
6351394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University