View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11170_low_8 (Length: 431)
Name: NF11170_low_8
Description: NF11170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11170_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 50 - 418
Target Start/End: Original strand, 781490 - 781858
Alignment:
| Q |
50 |
attttgagaataaatagttaacgtgaaactaatcatatattatgggaatgaaggaagattgtaagttatgatataaccatttaaatatatcttaatctta |
149 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
781490 |
attttgagaataagtagttaccgtgaaactaatcatatattatgggaatgaaggaagattgtaagttatgatataaccatttaaatatatcttaatctca |
781589 |
T |
 |
| Q |
150 |
tagttgatcaataagattttataaaattattgagacactttttaaggtctctagtatgtcattgtatgtttggttcaacataagggtagatggtaaatat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781590 |
tagttgatcaataagattttataaaattattgagacactttttaaggtctctagtatgtcattgtatgtttggttcaacataagggtagatggtaaatat |
781689 |
T |
 |
| Q |
250 |
ttaagagtagatatggtaaatatttgtcattcttattgtgaaacggatatgatgtgatcttagcgatacttatactttgtatgagacttgtaagatccac |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
781690 |
ttaagagtagatatggtaaatatttgtcattcttattgtgaaacggatatgatgtgatcttggcaatacttatactttgtatgagacttgtaaggtccac |
781789 |
T |
 |
| Q |
350 |
attatgcaattaattcttgctgannnnnnnnnaagagtaacttctagtttaattttctcgtattcatct |
418 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781790 |
attatgcaattaattcttgctgatttttttttaagagtaacttctagtttaattttctcgtattcatct |
781858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University