View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_high_29 (Length: 322)
Name: NF11171A_high_29
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 28 - 150
Target Start/End: Complemental strand, 39065977 - 39065855
Alignment:
| Q |
28 |
gtactactccctgttatgttgttctacgcgcatgcacaaatgcaatcattataaaaatggttagggttttgttcatcttcttactaactaactggacttt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39065977 |
gtactactccctgttatgttgttctacgcgcatgcacaaatgcaatcattataaaaatggttagggttttgttcatcttcttactaactaactggacttt |
39065878 |
T |
|
| Q |
128 |
ggggtaccaaaatgaactaatta |
150 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39065877 |
ggggtaccaaaatgaactaatta |
39065855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 198 - 241
Target Start/End: Complemental strand, 39065797 - 39065754
Alignment:
| Q |
198 |
tgggtcatgtcaactagtgttcttgaaacattggttgagaaaac |
241 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39065797 |
tgggtcaagtcaactagtgttcttggaacattggttgagaaaac |
39065754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University