View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_high_43 (Length: 247)
Name: NF11171A_high_43
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 230
Target Start/End: Complemental strand, 19506528 - 19506320
Alignment:
| Q |
22 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506528 |
cagtagtctctgagactctcatatctcactggattcccaacagatgaacctacgtgatatatgctatcatcacaaggttgatttgcatgacttaccatgg |
19506429 |
T |
|
| Q |
122 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506428 |
ccactagcattgcattcaccaccatatcagcagggatctgcttcaaattaacacaagcataagtataaatcaattttgtctaggcctaattatacattta |
19506329 |
T |
|
| Q |
222 |
gttatgtta |
230 |
Q |
| |
|
||||||||| |
|
|
| T |
19506328 |
gttatgtta |
19506320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 164
Target Start/End: Original strand, 36194208 - 36194326
Alignment:
| Q |
43 |
tatctcactggattcccaacagatgaacccacatgatatatgctatcatcacaaggttgatttgcatgacttaccatggccactagcattgcattcacca |
142 |
Q |
| |
|
||||||| ||| || | |||||| |||||||||||||||| | |||| | |||||||||||||||| ||||| ||||||| ||||||||| |||| |
|
|
| T |
36194208 |
tatctcaatgggtttctaacagaggaacccacatgatataccc---catctctaggttgatttgcatgagccaccatagccactaacattgcattgacca |
36194304 |
T |
|
| Q |
143 |
ccatatcagcagggatctgctt |
164 |
Q |
| |
|
|||| ||||| || |||||||| |
|
|
| T |
36194305 |
ccatgtcagctggtatctgctt |
36194326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University