View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_high_47 (Length: 230)
Name: NF11171A_high_47
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 37181788 - 37182005
Alignment:
| Q |
1 |
ggtcattacaggactatactgcagacttagagtcttggagaggattcaattttcaaaaatgaacataatgacaatgtgaggtatttcgtagtctttatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
37181788 |
ggtcattacaggactatactgcagacttagagtcttggagaagattcaattttcaaaaatgaacataatgacaatgtgaggtatttcatagtttttatca |
37181887 |
T |
 |
| Q |
101 |
ttaagctatttcatgaattcaattgttactacatgcgttttttaccattttacaaagataagtctggctcctcacatagtatcgctatctatcatgctca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37181888 |
ttaagctatttcatgaattcaattgttactacatgcgttttttaccattttacaaagataagtttggctcctcacatagtatcgctatctatcatgc--- |
37181984 |
T |
 |
| Q |
201 |
tgtatttactagtattgtcgtcta |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37181985 |
---atttactagtattgtcgtcta |
37182005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University