View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_high_52 (Length: 214)
Name: NF11171A_high_52
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 39696752 - 39696570
Alignment:
| Q |
13 |
catacgagatgatggaagaggcggagtctctcttctcgatacatttcccttctcacgcttcgatgctatcttcgacaaaatatctttatcatccttctta |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696752 |
catacgagaagatggaagaggcggagtctctcttctcgatacatttcccttctcacgcttcgatgctatcttcgacaaaatatctttatcatccttctta |
39696653 |
T |
 |
| Q |
113 |
gcagccctatcagacaaaatcatctctctttgaagttcagtcatctcagaaagtttctttctgtcatcctcatccttataaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39696652 |
gcagccctatcagacaaaatcatctctctttgaagttcagtcatctcagaaagtttctttctgtcatcctcatccttataaag |
39696570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 56 - 186
Target Start/End: Complemental strand, 35691669 - 35691539
Alignment:
| Q |
56 |
tttcccttctcacgcttcgatgctatcttcgacaaaatatctttatcatccttcttagcagccctatcagacaaaatcatctctctttgaagttcagtca |
155 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||| | | |||||| ||||| || | ||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
35691669 |
tttcctttctcacgctttgatgcaatctttcccaacaaacttttatcgtccttttttgaagccctatccgacaaaatcatctctctttgaagttcactca |
35691570 |
T |
 |
| Q |
156 |
tctcagaaagtttctttctgtcatcctcatc |
186 |
Q |
| |
|
|||||||||| ||| |||||||| ||||| |
|
|
| T |
35691569 |
tctcagaaagcttccgcctgtcatcttcatc |
35691539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University