View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_high_54 (Length: 208)
Name: NF11171A_high_54
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_high_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 24 - 192
Target Start/End: Original strand, 34890842 - 34891010
Alignment:
| Q |
24 |
tagttatggtatacagataattctctttagctgccaggttttgttaagcttcatgaaagcagaaaacatgtgtggagatttaccctttcatgataaatac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34890842 |
tagttatggtatacagataattctctttagctgccaggttttgttaagcttcatgaaagcagaaaacatgtgtggagatttaccctttcatgataaatac |
34890941 |
T |
 |
| Q |
124 |
atgggttgagtctagctggttttttcattataagttttatgtttcacattttctttgtctaatattatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34890942 |
atgggttgagtctagctggttttttcattataagttttatgtttcacattttctttgtctaatattatt |
34891010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University