View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_111 (Length: 282)
Name: NF11171A_low_111
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_111 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 266
Target Start/End: Original strand, 2383490 - 2383749
Alignment:
| Q |
7 |
gttaagacacatttttcacttggttttatgtcatcatcacaattgactgcttctgcagctgtttagcttcattcagaagttcctcaattgcttggatttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2383490 |
gttaagacacatttttcacttggttttatgtcatcatcacaattgactgcttctgcagctgtttagcttcattcagaagttcctcaattgcttggatttg |
2383589 |
T |
 |
| Q |
107 |
tggtacttgatttgtttcaaaattgactattctttttgtaaattatgttgtctcaattccttaaatctccactctagggtacttgagattgttatggttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2383590 |
tggtacttgatttgtttcaaaattgactattctttttgtaaattatgttggctcaattccttaaatctccactctagggtacttgagattgttatggttg |
2383689 |
T |
 |
| Q |
207 |
gttcaatttctagagtttgttatggttagttgtaattgtttgttgttaatgttatggtta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2383690 |
gttcaatttctagagtttgttatggttagttgtaattgtttgttgttaatgttatggtta |
2383749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University