View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_119 (Length: 273)
Name: NF11171A_low_119
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_119 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 267
Target Start/End: Complemental strand, 50157260 - 50157005
Alignment:
| Q |
12 |
agaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaaccgagacagtgccttggagatcataattgcttgatttcgatta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50157260 |
agaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaactgagacagtgccttggagattataattgcttgatttcgatta |
50157161 |
T |
 |
| Q |
112 |
aataattgaactcagttacagtaaaagtgacgagttttcaagttatgtatagaagacttttggataacaaggtaccagtgaatatgctgctcggcnnnnn |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50157160 |
aataattgaactcagttacagtaaaagtgacgagtgttcaagttatgtatagaatacttttggataacaatgtaccagtgaatatgctgctcggcaaaaa |
50157061 |
T |
 |
| Q |
212 |
nncttgtccaacatcaacttttagagtgcattcaaaccattccgaaattctaacga |
267 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157060 |
aacttgtccaacctcaacttttagagtgcattcaaaccattccgaaattctaacga |
50157005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University