View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_121 (Length: 271)
Name: NF11171A_low_121
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_121 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 37181790 - 37181530
Alignment:
| Q |
1 |
accattcagtgaaattctttttcaccatacttctcgtgcgtcccttgttttgtcgaaaatattttcgttcggattttaaaatttagagtgtgtttttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37181790 |
accattcagtgaaattctttttcaccatacttctcgtgcgtcccttgttttctcgaaaatattttcgtttggattttaaaatttagagtgtgtttttctt |
37181691 |
T |
 |
| Q |
101 |
gttcgaaatatataatctgaacgcattgtacatactatttgaatttgttctcttccaccacacttttattttatgaaattactcagtttagattatacta |
200 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37181690 |
gttcggaatatataatccgaacacattgtacatactatttgaatccgttctcttccaccaca-ttttattttatgaaattactctgtttagattatacta |
37181592 |
T |
 |
| Q |
201 |
taaatacatcaactttagttaattaatttgtctctcataaaaatgatcggaggtagtataat |
262 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37181591 |
taaatgcatcaactttagttaattaatttgtctctcataaaaatgatcggagagagtataat |
37181530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 243
Target Start/End: Original strand, 33012940 - 33012981
Alignment:
| Q |
202 |
aaatacatcaactttagttaattaatttgtctctcataaaaa |
243 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
33012940 |
aaatacatcaactttagttaatccatttgtctcttataaaaa |
33012981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University