View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_123 (Length: 271)
Name: NF11171A_low_123
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_123 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 21 - 271
Target Start/End: Complemental strand, 24511831 - 24511578
Alignment:
| Q |
21 |
atttaatgggatacatcttagttgtagttttgtttttctagatgaccgataggaactcttttacttcctataagt-tttagtcttttgcttattgttctt |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || | ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24511831 |
atttagtgggatacatcttagttgtagttttgtttcccttgttgaccgataggaactctttcacttcctataagtatttagtcttttgcttattgttct- |
24511733 |
T |
|
| Q |
120 |
gtggttagagtttaagccc-atttattcctaattaaaaaaatattcattcataatt---nnnnnnnnncatagtgcagtacaataccacnnnnnnngttt |
215 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| |||||||||| |||||||||||||||||| || |||| |
|
|
| T |
24511732 |
-tggttagagtttaagccctatttattcataattaaaaaaatatttattcataattaaaaaaaaaaaacatagtgcagtacaatacgactttttttgttt |
24511634 |
T |
|
| Q |
216 |
gtttgacttgtagtattgcagtacaatacgacttatttcctttattatagccaatg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24511633 |
gtttgacttgtagtattgcagtacaatacgacttatttcctttattatagccaatg |
24511578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University