View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_124 (Length: 269)
Name: NF11171A_low_124
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_124 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 259
Target Start/End: Original strand, 5726343 - 5726608
Alignment:
| Q |
7 |
taaactaattatttagtttggagttccaatttaaacctgtgcatatgaaaaatatatacccgaatatgtcaatatcataaaatgatatcaattaactcaa |
106 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726343 |
taaactaattatttagtttggagtttcaatttaaacctgtgcatatgaaaaatatatacccgaatatgtcaatatcataaaatgatatcaattaactcaa |
5726442 |
T |
 |
| Q |
107 |
aaggaatctctacgag--------------acattatttgtttgctaaggaaaaactaagaagttaagggtgcaaaaattaactctaaattttatgcttc |
192 |
Q |
| |
|
||||||||||| | | |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5726443 |
aaggaatctctgcaattgctcgtagatgttacattatttgtt-gctaaggaaaaactaagaagttaaggttgcaaaaattaactctaaattttatgcttc |
5726541 |
T |
 |
| Q |
193 |
attatgtcggcatatgttaatatcttaattaaattaaagaaatgctttttccagtctactatattct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
5726542 |
attatgtcggcatatgttaatatcttaattaaattaaagaaatgcttttttcagtctactattttct |
5726608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University