View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_132 (Length: 265)
Name: NF11171A_low_132
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_132 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 256
Target Start/End: Original strand, 6973728 - 6973970
Alignment:
| Q |
14 |
ttcttctttcttttttgataaacaaagtggtagacaagaattggttcaatatctcaacatggttgttcatagtaagtcttgtaactccttcccatgtgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6973728 |
ttcttctttcttttttgataaacaaagtggtagacaagaattggtttaatatctcaacatgattgttcatagtaagtcttgtaactccttcccatgtgta |
6973827 |
T |
 |
| Q |
114 |
tgttcttctatttttagcaaatttatcttgggcatcaaacaagtatcttacaagtgtaacctttgtttctttaatatatcttacatataacctatgaaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6973828 |
tgttcttctatttttagcaaatttatcttgggcatcaaacaagtatcttacaagtgtaacctttatttctttaatatatcttacatgtaacctatgaaaa |
6973927 |
T |
 |
| Q |
214 |
cgaacttggtatatgatggaaatggggaatccatgaaaatgga |
256 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6973928 |
cgaatttggtatatgatggaaatggggaatccatgaaaatgga |
6973970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University