View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_135 (Length: 264)
Name: NF11171A_low_135
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_135 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 29583617 - 29583810
Alignment:
| Q |
10 |
catagaaagagtgtacatccctttttgcgaatgagttgagtgagtatcactataaacctagagatgcaaaggatggaaaatctggagcataatccaagtg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29583617 |
catagaaagagtgtacatccctttttgcgaatgagttgagtgagtatcactataaacctagagatgccaaggatggaaaatctggagcataatccaagtg |
29583716 |
T |
 |
| Q |
110 |
tcattacgaatgaactctaatattatcttaaattttggtttggacctaactcaacctcacaatatcggtttgtaaggtaagggatatttctcac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583717 |
tcattacgaatgaactctaatattatcttaaattttggtttggacctaactcaacctcacaatatcggtttgtaaggtaagggatatttctcac |
29583810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 212 - 264
Target Start/End: Original strand, 29583921 - 29583973
Alignment:
| Q |
212 |
aaagctgtagttaatcagcgtagcaaattcatacgttggttatgatgccttac |
264 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
29583921 |
aaagctgtagttaatcaacgtagcaaattcagaagttggttatgatgccttac |
29583973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 187
Target Start/End: Original strand, 19809943 - 19809995
Alignment:
| Q |
135 |
tcttaaattttggtttggacctaactcaacctcacaatatcggtttgtaaggt |
187 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
19809943 |
tcttaaattttgggttgggcctaactcaaccttacaaaatcggcttgtaaggt |
19809995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University