View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_137 (Length: 261)
Name: NF11171A_low_137
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_137 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 15 - 168
Target Start/End: Original strand, 23472460 - 23472612
Alignment:
| Q |
15 |
tggcgcaattgttttcattcaggtcttcaggttgtttcctctcatatttttcgagaaggcaatgcttaagctgataagctagctaatcatggtcactcgg |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
23472460 |
tggcacaattgttttcattcaggtcttcaggttgtttgc-ctcatatttttcgagaaggcaatgcttgcgctgataagctagctaattatggtcactcgg |
23472558 |
T |
|
| Q |
115 |
ttcatggtgtctggtggtcggattctttaccggagattatatgtgatcccttct |
168 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
23472559 |
ttcacggtgtctgatggtcggattctttaccggagattatacgtgagcccttct |
23472612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 123
Target Start/End: Complemental strand, 35796152 - 35796044
Alignment:
| Q |
15 |
tggcgcaattgttttcattcaggtcttcaggttgtttcctctcatatttttcgagaaggcaatgcttaagctgataagctagctaatcatggtcactcgg |
114 |
Q |
| |
|
|||| ||| |||||| | |||||| | |||||||||||||||||||||||||| ||| |||||| ||| |||| |||||| || || ||||| |||||| |
|
|
| T |
35796152 |
tggcacaactgtttttaatcaggtatccaggttgtttcctctcatatttttcgtgaatgcaatgattacgctggtaagcttgcaaaccatggacactcga |
35796053 |
T |
|
| Q |
115 |
ttcatggtg |
123 |
Q |
| |
|
|||| |||| |
|
|
| T |
35796052 |
ttcaaggtg |
35796044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 65
Target Start/End: Original strand, 18706805 - 18706833
Alignment:
| Q |
37 |
gtcttcaggttgtttcctctcatattttt |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18706805 |
gtcttcaggttgtttcctctcatattttt |
18706833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 76
Target Start/End: Complemental strand, 27846061 - 27846025
Alignment:
| Q |
40 |
ttcaggttgtttcctctcatatttttcgagaaggcaa |
76 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
27846061 |
ttcaggttatttcctctcatattttccgagaaggcaa |
27846025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University