View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11171A_low_148 (Length: 254)

Name: NF11171A_low_148
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11171A_low_148
NF11171A_low_148
[»] chr6 (1 HSPs)
chr6 (5-75)||(3317722-3317793)


Alignment Details
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 75
Target Start/End: Original strand, 3317722 - 3317793
Alignment:
5 atacaatgagtaacacttatgatttcctctc-ttttttgaaatgttaagagctggattttggtcatcttgat 75  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||    
3317722 atacagtgagtaacacttatgatttcctctctttttttgaaatgttaagagttggattttggtcattttgat 3317793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University