View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_148 (Length: 254)
Name: NF11171A_low_148
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_148 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 75
Target Start/End: Original strand, 3317722 - 3317793
Alignment:
| Q |
5 |
atacaatgagtaacacttatgatttcctctc-ttttttgaaatgttaagagctggattttggtcatcttgat |
75 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
3317722 |
atacagtgagtaacacttatgatttcctctctttttttgaaatgttaagagttggattttggtcattttgat |
3317793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University