View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_152 (Length: 251)
Name: NF11171A_low_152
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_152 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 6915829 - 6916068
Alignment:
| Q |
7 |
tttcgtgttagcttggacccagagagtgggcaaacaatcatttctggaatgggagaactacacttagatatttatgttaaatgcattaagatggagtatg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6915829 |
tttcgtgttagcttggacccagagagtgggcaaacaatcatttctggaatgggagaactacacttagatatttatgttaaacgcattaagatggagtatg |
6915928 |
T |
|
| Q |
107 |
gtgttgatgctacagttggaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctgaaggaca |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
6915929 |
gggttgatgctacagttggaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctggagggca |
6916028 |
T |
|
| Q |
207 |
aggacaatatggacgagtgattggatatattgaaccactt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916029 |
aggacaatatggacgagtgattggatatattgaaccactt |
6916068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 109 - 230
Target Start/End: Complemental strand, 15039390 - 15039269
Alignment:
| Q |
109 |
gttgatgctacagttggaaagccccgggtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatctgaaggacaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||| |
|
|
| T |
15039390 |
gttgatgctacagttggaaagccccgtgtaaacttcagagaaactgttactcaacgtgctgattttgattatttacataagaagcaatccggagggcaag |
15039291 |
T |
|
| Q |
209 |
gacaatatggacgagtgattgg |
230 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
15039290 |
gacaatatggacgggtgattgg |
15039269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 40 - 94
Target Start/End: Complemental strand, 15039977 - 15039923
Alignment:
| Q |
40 |
acaatcatttctggaatgggagaactacacttagatatttatgttaaatgcatta |
94 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||||| || |||||| |
|
|
| T |
15039977 |
acaattatttctggaatgggagaactgcacttagatatctatgttgaacgcatta |
15039923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University