View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_154 (Length: 250)
Name: NF11171A_low_154
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_154 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 45123338 - 45123582
Alignment:
| Q |
1 |
atagtattattttctagttgttattggacaatgatcatagtttcgtctccgctttttgaagtttccacctatgttgtgattgtgtttctttattttcttt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
45123338 |
atagtattattttctagttgtcattggacaatgatcatagtttcgtctccgctttttgaagtttctacctatgttgtgattgtgtttctttattttctct |
45123437 |
T |
|
| Q |
101 |
atgttgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatgtatccttctatgaatgtctattacagaatattatgaatattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45123438 |
atgttgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatatatccttctatgaatgtctattacaaaatattatgaatattag |
45123537 |
T |
|
| Q |
201 |
tgatgatgtattgattaaatgtatttttaacggtcttcatctcag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123538 |
tgatgatgtattgattaaatgtatttttaacggtcttcatctcag |
45123582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University