View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_158 (Length: 250)
Name: NF11171A_low_158
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_158 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 55 - 245
Target Start/End: Complemental strand, 3271914 - 3271724
Alignment:
| Q |
55 |
aacatttgttccatgcattcaccgtttgtccaaatgttagaacatctgcttaaattcaatgtcttaaacaattgtctctatgtgatggaagggtatatat |
154 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3271914 |
aacatttgttccatgtattcaccgtttgtccaaatgttagaacatctgcttaaattcaatgtcttaaacaattgtctctatgtgatggaagagtatatat |
3271815 |
T |
 |
| Q |
155 |
tgatcattcacagaggtccagattggatttcaataccattacaaattgaatatgataccataaatgatagtaataaactattcatatcagt |
245 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
3271814 |
tgatcattcacagagctccagattggatttcaataccattacaaattgaataggataccataaatgatagtaatgaactattcatgtcagt |
3271724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 3271968 - 3271931
Alignment:
| Q |
1 |
atcatattagattttttgtctctcagctcagcatagcg |
38 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3271968 |
atcatattagattctttgtctcacagctcagcatagcg |
3271931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University