View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_162 (Length: 249)
Name: NF11171A_low_162
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_162 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 22 - 249
Target Start/End: Original strand, 6917429 - 6917656
Alignment:
| Q |
22 |
cagttctgcaacaggaaacaggtactatccggagacgagtttgaagccgggagcacttcgctccccatacagaggtcacaactgtccagaaaggcaagtt |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6917429 |
cagttctgcaacagggaacaggtactatccggagacgagtttgaagccgggagcacttcgctccccatacagaggtcacaactgtccagaatggcaagtt |
6917528 |
T |
 |
| Q |
122 |
ccaggccatcaagattgagcgcggcgaggttgattccgaaacatataggttctgattttccttttgcttgttgtttgagcacactcaatataaaatgcta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917529 |
ccaggccatcaagattgagcgcggcgaggttgatttcgaaacatataggttctgattttccatttgcttgttgtttgagcacactcaatataaaatgcta |
6917628 |
T |
 |
| Q |
222 |
aatgcacagacttattattcaataataa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6917629 |
aatgcacagacttattattcaataataa |
6917656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University