View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_167 (Length: 247)
Name: NF11171A_low_167
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_167 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 6917703 - 6917921
Alignment:
| Q |
1 |
aagtgataagtaatttttgcactatttgatgactgttcttggcacacatgcatgctgtttccacgcctgtgttatggttggttgagaggctatgatgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917703 |
aagtgataagtaatttttgcactatttgatgactgttcttggcacatatgcatgatgtttccacgcctgtgttatggttggttgagaggctatgatgtta |
6917802 |
T |
|
| Q |
101 |
acataatttgtccactggtgttgaaaagtcaaatggcttatgtcatgagaacaacaaggttacatggtcgtttccaagatcaatggtaaaggttaaaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
6917803 |
acataatttgtccactggtgttgaaaagtcaaatggcttatgtcatgagaacaacaaggttacatggtcatttccaagatcaacggtaaaggttaaaaac |
6917902 |
T |
|
| Q |
201 |
ttgaagtaatggtaatttg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6917903 |
ttgaagtaatggtaatttg |
6917921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University