View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_173 (Length: 246)
Name: NF11171A_low_173
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_173 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 23 - 235
Target Start/End: Complemental strand, 7431025 - 7430820
Alignment:
| Q |
23 |
taacacagacaccggacatgttgacaccggtaatagtattaaaacatgtaatattgaatgtaactgtatgtgaagtcttggtggttggtgctatatgggt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
7431025 |
taacacagacaccggacatgttgacaccggtaatagtattaaaacatgtaatattgaatgtaactggatgtgaagtcttggtg-------ctatatgggt |
7430933 |
T |
 |
| Q |
123 |
tatatagaacttgattttgttttgattactgtgaaggtgatcgttttgaaattgtgtttgcttgaatagctagcttacttttgcattagatgaaagattg |
222 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430932 |
tatatagaacttgattttgttttgaatagtgtgaaggtgatcgttttgaaattgtgtttgcttgaatagctagcttacttttgcattagatgaaagattg |
7430833 |
T |
 |
| Q |
223 |
gttttgatgtcca |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7430832 |
gttttgatgtcca |
7430820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University