View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_179 (Length: 244)
Name: NF11171A_low_179
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_179 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 27 - 228
Target Start/End: Original strand, 26995276 - 26995491
Alignment:
| Q |
27 |
aaaatattaggataagaacca--gttacattccaaattagatgctatatgaataagatctaccatttgtgtaatcaaattgggcacaatgctgaaatgta |
124 |
Q |
| |
|
|||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26995276 |
aaaatattagaataggaaccacagttacattccaaattagatgctatatgaataagatctaccatttgtgtaatcaaattgggcacaatgctgaaatgta |
26995375 |
T |
 |
| Q |
125 |
ttataagaaacatgactgcaaaacata------------aaaggcatattggcaatgctacaaggatcagcaggtgcatctcataatctttctgccagtc |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
26995376 |
ttataagaaacatgactgcaaaacatattatttaaactgaaaggcatattggcaatgctacaaggatcagcaggtgcatctcataatctttctgccggcc |
26995475 |
T |
 |
| Q |
213 |
gaattgtgaccgcttc |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26995476 |
gaattgtgaccgcttc |
26995491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University