View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_181 (Length: 243)
Name: NF11171A_low_181
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_181 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 2651398 - 2651171
Alignment:
| Q |
1 |
ttggtcctttttgtgaacaacttttttatttagtagttacaaaacaatatatata----gattcagaagtattgcagaatcatcaattgggtgaaacttc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651398 |
ttggtcctttttgtgaacaacttttttatttagtagttacaaaacaatatatatatatagattcagaagtattgcagaatcatcaattgggtgaaacttc |
2651299 |
T |
 |
| Q |
97 |
tgatgcttttgctcaagtaagaaaaatccaacaatactgagcaataaagaggaaaatgtttttgtcttatgtagcatttgcttgtaggcaatgttttaaa |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651298 |
tgatgcttttgctcaagtgagaaaaatccaacaatactgagcaataaagaggaaaatgtttttgtcttatgtagcatttgcttgtaggcaatgttttaaa |
2651199 |
T |
 |
| Q |
197 |
attatgtggtccatgaggctatgacatc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2651198 |
attatgtggtccatgaggctatgacatc |
2651171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University