View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_182 (Length: 243)
Name: NF11171A_low_182
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_182 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 108 - 235
Target Start/End: Complemental strand, 21148613 - 21148486
Alignment:
| Q |
108 |
cattcctcacatggggatcaatccttgaggattgacaaaccttgagagtccaacattcgcaatgcactacaatccgtagtttcaaattgcggaccacata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21148613 |
cattcctcacatggggatcaatccttgaggattgacaaaccttgagagtccaacattcgcaatgcactacaatccgtagtttcaaattgcggaccacata |
21148514 |
T |
|
| Q |
208 |
atgcgattggccacaatagtgtgggttt |
235 |
Q |
| |
|
| |||| |||||||||||||||||||| |
|
|
| T |
21148513 |
acacgatcggccacaatagtgtgggttt |
21148486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University