View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_185 (Length: 243)
Name: NF11171A_low_185
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_185 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 7407440 - 7407657
Alignment:
| Q |
18 |
atcatagaaaagccgagtaattttggcttgttgcatatatataaacatacatagaaatgagaatagatcgttttcaaggggctaattaatttttagtcgt |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7407440 |
atcatagaaaagcctagtaattttggcttgttgcatatatataaacatacatagagatgagaatagatcgttttcaaggggctaattaatttttagtcgt |
7407539 |
T |
|
| Q |
118 |
tggttgaacctttggaggaatctgagatgattttctgtagcatctggtttgtctcttcctcgggcattcgctcgtctttactctttgattttgcataagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7407540 |
tggttgaacctttggaggaatctgagatgattttctgtagcatctggtttgtctcttcctcggacattcgctcgtctttactctttgattttgcataagc |
7407639 |
T |
|
| Q |
218 |
ctcaaaaaattctttgtt |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7407640 |
ctcaaaaaattctttgtt |
7407657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University