View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_186 (Length: 243)
Name: NF11171A_low_186
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_186 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 4055130 - 4054911
Alignment:
| Q |
20 |
cataacagtaatatctttgtttctctgtttctcttccccaacaacattgatatgtctttctaaactccaacgttaaacaaaacaaaatttgtttcagaag |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4055130 |
cataacagtgatatctttgtttctctgtttctcttccccaacaacattgatatgtctttctaaacaccaacgttaaacaaaacaaaatttgtttcagaag |
4055031 |
T |
 |
| Q |
120 |
acactctttgtttcgaagtttgactgtgttt-atgtgtttttctctcgaagtgtctacacaaagtaaaatccgaatagggttattgggtcggtgggtcgg |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4055030 |
acactctttgtttcgaagtttcactgtgtttaatgtgtttttctctcgaactgtctacacaaagtaagatccgaatagggttattgggtcggtgggtcgg |
4054931 |
T |
 |
| Q |
219 |
gtcatcatattcttggacat |
238 |
Q |
| |
|
|||||| | || |||||||| |
|
|
| T |
4054930 |
gtcatcgttttattggacat |
4054911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University