View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_189 (Length: 242)
Name: NF11171A_low_189
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_189 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 140 - 225
Target Start/End: Original strand, 6823977 - 6824062
Alignment:
| Q |
140 |
aggctttattatgccaaaattggaattggaactccgtcaagggattattatttgcaagtggatactggaactgatatgatgtgggt |
225 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6823977 |
aggctttattatgcgaaaattggaattggaactccgtcaaaggattattatttgcaagtggatactggaactgatatgatgtgggt |
6824062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 10 - 70
Target Start/End: Original strand, 6823858 - 6823918
Alignment:
| Q |
10 |
ataatactcaaattagtctctgactcagtataacatagggaagagaccatcgttgatttag |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | || |||||||||| |
|
|
| T |
6823858 |
ataatactcaaattagtctctgactcagtataacatagggaagatattattgttgatttag |
6823918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University