View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_190 (Length: 242)
Name: NF11171A_low_190
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_190 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 48 - 218
Target Start/End: Original strand, 43703392 - 43703561
Alignment:
| Q |
48 |
caattttataaacttatgttcatctaaaaccacccttatcgaacacttgcccaaatgcacactctttttcgtattgataatgaattacttttgttggttc |
147 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43703392 |
caattttataaacttatgtttatctaaaaccacctttatcgaacacttgcccaaatgcacactttttttcgtattgataatgaattacttttgtt-gttc |
43703490 |
T |
 |
| Q |
148 |
aaccacctacattgaggaatcaaaatactagttgtgtttgttttgtgagattcttatcttgtgattggtcc |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43703491 |
aaccatctacattgaggaatcaaaatactagttgagtttgtcttgtgagattcttatcttgtgattggtcc |
43703561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University