View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_193 (Length: 240)
Name: NF11171A_low_193
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_193 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 181
Target Start/End: Complemental strand, 32314697 - 32314659
Alignment:
| Q |
143 |
ttaatttggcatgaatataatgagtttgttgctgtcatt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32314697 |
ttaatttggcatgaatataatgagtttgttgctgtcatt |
32314659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 181
Target Start/End: Original strand, 32308951 - 32308986
Alignment:
| Q |
146 |
atttggcatgaatataatgagtttgttgctgtcatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32308951 |
atttggcatgaatataatgagtttgttgctgtcatt |
32308986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University