View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_205 (Length: 234)
Name: NF11171A_low_205
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_205 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 2257397 - 2257171
Alignment:
| Q |
1 |
atataacataaaagaaataagcaattggttgaaaaatgaccaccctgtgttgccaaaatcccgaggcttcaatgaaatagttagcgaacgagacgggtgt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
2257397 |
atattacataaaagaaataagcaattggttgaaaaatcaccaccctgtgttgccaaaatcacaaggcttcaatgaaataggtagcgaacgtgacgggtgt |
2257298 |
T |
|
| Q |
101 |
gatgctcaatcgatccttccatgcttcagagaccgggaacataaactcgacatcaaatacatcggatttgagaaaatttgattcttcgcacggttttcat |
200 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2257297 |
gatgctcaatcgatcattccatgccacagagaccgggaacataaacttgacaacaaacacatcggatttgagaaaatttgattcttcgcacggttttcat |
2257198 |
T |
|
| Q |
201 |
ccatattcacaactttcaactgttttc |
227 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
2257197 |
ccatatccacaactttcaactgttttc |
2257171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University