View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_212 (Length: 231)
Name: NF11171A_low_212
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_212 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 12 - 131
Target Start/End: Complemental strand, 32096520 - 32096401
Alignment:
| Q |
12 |
aagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096520 |
aagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtg |
32096421 |
T |
|
| Q |
112 |
atgctttgttggaggttgag |
131 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
32096420 |
atgctttgttggagattgag |
32096401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 48154299 - 48154347
Alignment:
| Q |
165 |
gatcagtgttgtgttaggaggtagcgaagagtttggagggggtttttat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48154299 |
gatcagtgttgtgttaggaggtagcgaagagtttggagggggtttttat |
48154347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University