View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_213 (Length: 231)
Name: NF11171A_low_213
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_213 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 3 - 212
Target Start/End: Original strand, 27491921 - 27492130
Alignment:
| Q |
3 |
agaatatgagcatgtgtgtgtttggttatgtatgtgacacaaaccaannnnnnnaatgaattcattttgtaaaattggttgtgcttaaagtgatgtgtgc |
102 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27491921 |
agaaaatgagcatgtgtgtgtttggt-atgtatgtgacacaaaccaatttttttaatgaattcattttgtaaaattggttgtgcttaaagtgatgtgtgc |
27492019 |
T |
 |
| Q |
103 |
ttcattttctagtgataataaatgttttgagtgaattaactttttgaaattgagtaccatt-aacataaattgaatataaagagatttatattttaatgt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || || |||| ||||| ||| ||||||| ||||||||| |
|
|
| T |
27492020 |
ttcattttctagtgataataaatgttttgagtgaattaactttttgaaattgagtacgattaaaaatgaatttaatatgaagtgatttatgttttaatgt |
27492119 |
T |
 |
| Q |
202 |
gtgatatttat |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
27492120 |
gtgatatttat |
27492130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University