View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_240 (Length: 229)
Name: NF11171A_low_240
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_240 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 32706447 - 32706669
Alignment:
| Q |
1 |
aaaaattgaacttgtactatggatgagcaaaagtaagtgcagccgataaatcgattatgtacttgccttatagcatcatctttgaatttgacaatttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32706447 |
aaaaattgaacttgtactatggatgagcaaaagtaagtgcagccgataaatcgattatgtacttgccttatagcatcatctttgaatttgacaatttccc |
32706546 |
T |
|
| Q |
101 |
taatcatttgccaaaaataaggattcaatgcatttctcttctgtgcgaataagccagacaaacttctgctgccccattcgcagccacggcctttgtctag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32706547 |
taatcatttgccaaaaataaggattcaatgcatttctcttctgtgcgaataagccggacaaacttctgctgccccattcgcagccacggcctttgtctag |
32706646 |
T |
|
| Q |
201 |
gctgacagaaaatgacatgtctg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32706647 |
gctgacagaaaatgacatgtctg |
32706669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University