View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_245 (Length: 228)
Name: NF11171A_low_245
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_245 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 222
Target Start/End: Complemental strand, 3129074 - 3128879
Alignment:
| Q |
22 |
ttaattaatactaccaacaactttcattttcttcagaaatgcaagaaccaagcttagggatgatgcagggtggtggtggtgtttacggcggagatggtgg |
121 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
3129074 |
ttaattaatactaacaacaacttta-----cttcagaaatgcaagaaccaagcttagggatgatgcagggtagtggtggtggttacggcggagatggtgg |
3128980 |
T |
|
| Q |
122 |
cggtgagaacagacaactgaaggcggagatagcaacacatcctttgtatgaacagcttctgtctgcacatgtagcatgtcttcgagttgctactcctata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3128979 |
cggtgagaacagacaactgaaggcggagatagcaacacatcctttgtatgaacagcttctgtctgcacatgtagcatgtcttcgagttgctactcctata |
3128880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University