View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_246 (Length: 228)
Name: NF11171A_low_246
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_246 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 34142476 - 34142580
Alignment:
| Q |
1 |
agtttcaaagtgacttttaatatcttgattaatctctcccttgataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142476 |
agtttcaaagtgacttttaatatcttgattaatctctcccttaataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaatc |
34142575 |
T |
 |
| Q |
101 |
cagta |
105 |
Q |
| |
|
||||| |
|
|
| T |
34142576 |
cagta |
34142580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University