View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11171A_low_246 (Length: 228)

Name: NF11171A_low_246
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11171A_low_246
NF11171A_low_246
[»] chr3 (1 HSPs)
chr3 (1-105)||(34142476-34142580)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 34142476 - 34142580
Alignment:
1 agtttcaaagtgacttttaatatcttgattaatctctcccttgataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaatc 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34142476 agtttcaaagtgacttttaatatcttgattaatctctcccttaataacatttggctttggcaactctacaatcgaacagagttatccgtgagacagaatc 34142575  T
101 cagta 105  Q
    |||||    
34142576 cagta 34142580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University