View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_251 (Length: 225)
Name: NF11171A_low_251
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_251 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 32227351 - 32227132
Alignment:
| Q |
6 |
atttagttgtctcacgtgcacttgttcttaaaaatgaattgatttttatccttcttcaaatatgatctcgaggtgaatggtgtgaatagaagttttgttt |
105 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32227351 |
atttagttgtctcatgtgcacctgttcttaaaaatgaattgatttttatcctcctccaaatatgatcttgaggtgaatggtgtgaatagaagttttgttt |
32227252 |
T |
|
| Q |
106 |
ctgcatcccaattttggactgttaatacttgagtttaatattgacaatgagtgtttagatatggattccataaggagtatagaatcatttcaatttatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32227251 |
ctgcatcccaattttggactgttaatacttgagtttaatattgacaatgagtgtttaggtatggattccataaggagtatagaatcatttcgatttatca |
32227152 |
T |
|
| Q |
206 |
agtccaacaatttggaggga |
225 |
Q |
| |
|
|| | ||||||||||||||| |
|
|
| T |
32227151 |
agactaacaatttggaggga |
32227132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University