View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_253 (Length: 223)
Name: NF11171A_low_253
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_253 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 213
Target Start/End: Complemental strand, 49484365 - 49484174
Alignment:
| Q |
22 |
ggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaagcaattgaggatgctattgagacggatcctactggtgatgttaatcgtatt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
49484365 |
ggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaaacaattgaggatgctattgagacagatcctactggtgatgttaattgtatt |
49484266 |
T |
 |
| Q |
122 |
tctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcagatgtccatctcat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49484265 |
tctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcagatgttgatctcat |
49484174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 181
Target Start/End: Original strand, 55072199 - 55072247
Alignment:
| Q |
133 |
agtgagtagcaaaatattggccatggtcattgaatactgcaagaagcac |
181 |
Q |
| |
|
||||| ||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
55072199 |
agtgaatagcaaaatgttgagcatggtcgttgaatactgcaagaagcac |
55072247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University